| Cluster Contents | |
|---|---|
| Total G4 sequences | 126,123 |
| By G4hunter | 0 |
| By regular expression | 126,123 |
| Average Sequence Length | 24 |
| Number of associated genomes | 129 View Genomes |
| Taxonomic Distribution | |
|---|---|
| Bacteria | 0 % |
| Archaea | 0 % |
| Eukaryota | 100 % |
| Viruses | 0 % |
| Multiple Sequence Alignment |
|---|
| Note: For efficiency, the top 1000 sequences of the alignment are shown. To view the full alignment, please use the Multiple Sequence Alignment button at the top of the page. |
| Sequence Logo |
|---|
| Representative Sequence | ||||||
|---|---|---|---|---|---|---|
| Organism Group | Genome | Name | Contig | Start | End | Detection Method |
| Eukaryota (Plants) | GCA_000090985.2 | Micromonas commoda | CP001330.1 | 280 | 304 | Regular Expression |
| Sequence | ||||||
| CCCTAAACCCTAAACCCTAAACCC | ||||||